Healthcare Professional

Welcome to the Rare Haematology Resource Centre. This site is intended for healthcare professionals in Australia and New Zealand only. By clicking the link below, you are declaring and confirming that you are a healthcare professional.

You are here

A rare form of Gaucher disease resulting from saposin C deficiency

Blood Cells, Molecules, and Diseases, In Press, Corrected Proof, Available online 3 April 2017, Available online 3 April 2017

Abstract

Gaucher disease is mainly caused by the deficiency of lysosomal acid β-glucosidase. Gaucher disease caused by the deficiency of saposin C is rare. Here we report a patient mainly presenting with hepatosplenomegaly, thrombocytopenia and anemia. EEG examination revealed increased theta waves. Gaucher cells identified in his bone marrow and the highly elevated plasma chitotriosidase activity and glucosylsphingosine supported a diagnosis of Gaucher disease. However, the leukocyte β-glucosidase activity was in a normal range. Sanger sequencing revealed a novel maternal exonic mutation c.1133C > G (p.Pro378Arg) in exon 10 of the PSAP gene, which codes the Sap C domain of PSAP protein. To search for other underlying mutations in this patient, whole genome sequencing was applied and revealed a deletion involving exon 2 to 7 of PSAP gene. The deletion appears as a de novo event on paternal chromosome. We concluded that biallelic mutations of PSAP gene were the cause of this patient's Gaucher disease. Our finding expands the mutation spectrum of Gaucher disease with saposin C deficiency.

Keywords: Gaucher disease, Prosapsin, Saposin C.

1. Introduction

Gaucher disease (GD), one of the most common lysosomal storage diseases, is caused by the accumulation of glucocerebroside in the monocyte-macrophage system [1]. The degradation of glucocerebroside requires the participation of two proteins, lysosomal enzyme β-glucosidase (GBA) and sphingolipid activator protein saposin (Sap) C [2]. However, the vast majority of GD is caused by deficiency of β-glucosidase, which results from mutations in β-glucosidase gene [3]. Sap C deficiency is a rare reason for GD [2].

Three clinical subtypes of GD have been defined based on the severity of manifestations, age of onset and neurological involvement [4]. Type 1 is non-neuronopathic form, type 2 known as acute neuronopathic, while type 3 presents with slowly progressive neurological involvement [5].

The PSAP gene is localized on chromosome 10q21 and spans 17 kb of genomic DNA. It consists of 15 exons and 14 introns [6], encoding a protein of 524 amino acids, which includes a signal peptide and four homologous saposin domains [6]. A total of 22 mutations have been reported in the PSAP gene in the Human Gene Mutation Database (HGMD). These mutations include missense, splicing, small deletion, and gross deletion.

PSAP is a glycoprotein which could either be secreted into the extracellular space or transported to lysosomes [7]. It is firstly synthesized as a 55 kDa protein and then delivered to endoplasmic reticulum and Golgi apparatus to add sugar residues [7] and [8]. After glycosylation, two kinds of mature proteins are generated, a fully glycosylated 70 kDa isoform and a partially glycosylated 65 kDa isoform [6] and [7]. The fully glycosylated PSAP can be observed in seminal fluid, cerebrospinal fluid, plasma, maternal milk, pancreatic juice and brain, and has specific effects on the construction of reproductive and nervous systems [6] and [9]. The 65 kDa isoform, which could be divided into four sphingolipid activator proteins (Sap) [7].

The four Saps are named as Sap A, B, C and D. Each Sap contains 80 amino acids and has three disulfide bridges formed by the conserved cysteines at similar position [10]. Take Sap C as an example, the three disulfide bridges are Cys315- Cys388, Cys318- Cys382, and Cys346- Cys357[11]. The disulfide bridges play crucial roles in stabilizing Saps conformation, make the structure able to withstand even in acid environment, or in very high temperatures [2].

Saps are enzymatic activators for the hydrolysis of sphingolipid in lysosomes [12].These activator proteins play important roles in the hydrolysis of lysosomal sphingolipid degradation, such as the catabolism of galactosylceramide, cerebroside sulfate, lactosylceramide, glucocerebroside and ceramide [9]. PSAP deficiency or individual Sap deficiency could result in various lysosomal storage diseases. The deficiency of Sap A, B, and C, lead to late-onset Krabbe disease, Metachromatic leukodystrophy, and Gaucher disease, respectively [3], [6], and [11]. Sap D deficiency, which has been studied in an animal model, can cause ceramide lipidosis in mice, resembling human Farber disease [11] and [13].

In this paper, we present the clinical, biochemical, and genetic characters of a Chinese case of type 1 Gaucher disease caused by saposin C deficiency.

2. Materials and methods

2.1. Clinical characters

The patient is the first son of a healthy non-consanguineous Chinese couple and was born via spontaneous vaginal delivery without complications. Birth weight was 4000 g. His parents recalled him having an enlarged abdomen from the age of 2 years which did draw enough attention to take him to seek medical help. His family members did not have a similar abnormality. He achieved an average schooling score at a local primary school. At the age of 10 years and 4 months, the patient presented to local hospital due to frequent epistaxis over the previous two years. His height was 138.7 cm (− 1SD), and weight was 33 kg (− 1SD). Physical examination revealed hepatosplenomegaly with liver reached 9 cm under the right costal arch and the spleen reached 14 cm under the left costal arch. No bone pain was complained of and there were no detectable signs of any neurological involvement. Routine Blood examination showed profound thrombocytopenia of 31 × 109/L and mild anemia with hemoglobin 113 g/L. Prothrombin time was 14.4 s (reference: 10.0–15 s) and activated partial thromboplastin time was slightly increased with a value of 50.7 s (reference: 28–44 s). Blood biochemical tests were unremarkable except for a direct bilirubin slightly out of normal range at 6.43 μmol/L (reference: 0–6.0 μmol/L). Electroencephalogram (EEG) recording revealed increased theta waves at high amplitude in the lobus parietalis and occipitalis. Abdominal computed tomography scanning revealed no additional abnormality except for hepatosplenomegaly. Multiple cystic low-density lesions were seen in the bone marrow cavity of left femur and a bone marrow biopsy identified typical Gaucher cells. Thus, Gaucher disease was suspected and the patient was referred to our genetic metabolism outpatient clinic for a definite diagnosis. To confirm the diagnosis of GD, we measured the leukocyte β-glucosidase activity from peripheral blood and plasma chitotriosidase activity and glucosylsphingosine, two well-recognized biomarkers for GD, were quantified. The β-glucosidase activity in peripheral blood leukocytes was 11.56 nmol/h mg protein (reference: 6.56–55.10 nmol/h mg protein) and chitotriosidase value was 11,851.2 nmol/mL h (reference: 3–47 nmol/mL h). The plasma glucosylsphingosine was 50.29 ng/mL (reference: 0.17 to 1.18 ng/mL) [14]. The normal β-glucosidase activity and remarkably elevated chitotriosidase and glucosylsphingosine prompted us to conduct the PSAP gene testing. Blood samples were prepared from the patient and his parents after obtaining informed consent. All procedures followed were approved by the local committee on human experimentation (XHEC-D-2014-006) and were in accordance with the Helsinki Declaration of 1975, as revised in 2000.

2.2. Sequencing of genomic DNA

Genomic DNA was extracted from peripheral blood obtained using e.Z.N.A. blood DNA Kit (OMEGA, USA). The exonic sequences and flanking intronic sequences of the PSAP gene were amplified with primers designed by primer premier 5.0. DNA was initially predenatured for 5 min at 95 °C; followed by 35 cycles with each cycle including denaturation for 40 s at 95 °C, annealing for 40 s at 60 °C, extension for 50 s at 72 °C; finally DNA were extended at 72 °C for 10 min. The PCR products were sequenced by Sangon Biotech (Shanghai). Sequencing data was aligned with the reference sequences from NCBI (NM_002778).

2.3. RNA expression of PSAP gene

Blood samples were stored in the PAXgene™ blood RNA tube. RNA was isolated using the PAXgene™ blood RNA kit (Qiagen) according to the manufacturer's protocol and was reversely transcribed using PrimeScript™ RT reagent kit (TaKaRa, Japan). The reaction included 500 ng RNA, 2 μL 5 × PrimeScript RT Master Mix, and RNase-free ddH2O to make a final volume 10 μL. The sample was incubated at 37 °C for 15 min, then heated for 5 s at 85 °C. The reverse-transcribed cDNA was amplified with four pairs of primers that were designed to amplify the whole sequence. The obtained amplicons were finally sequenced bidirectionally by Sangon Biotech (Shanghai).

2.4. Whole genome sequencing

Genomic DNA was quantified precisely by Qubit DNA Assay Kit in Qubit®2.0 Flurometer (Life Technologies, CA, USA). A total amount of 1 μg DNA was supplied for library generation. The paired-end DNA libraries were prepared according to manufacturer's instructions (Illumina Truseq Library Construction) and were sequenced on Illumina Hiseq X according to manufacturer's instructions for paired-end 150 bp reads. After that, valid sequencing data was mapped to the reference genome (UCSC hg19) by Burrows-Wheeler Aligner(BWA) software [15] to get the original mapping result and reads that aligned to genomic regions were collected for mutation identification and subsequent analysis.

2.5. Quantitative real-time polymerase chain reaction (PCR)

Since a large deletion was identified by whole genome sequencing in the proband, DNA of the patient and his parents was then analyzed by quantitative real-time PCR to confirm the presence of deletion and to trace the parental origin. Exon 2, 7 and 8 were amplified with primers designed by Primer 5.0 with the length of all amplification products less than 400 bp. Primers specific for β-action was used as an endogenous control. The procedure was carried out in triplicate samples using a 7500 real-time PCR System (Applied Biosystems, USA). The reaction were in a total volume of 20 μL contained 10 μL of 2 × SYBR Premix (TaKaRa, Japan),0.4 μL of ROX II, 0.4 μL of each primer, 6.8 μL of ddH2O, and 2 μL of DNA (10 ng/μL). After PCR reaction, the dissociation curves were checked and cycle threshold (CT) values were collected. Relative Quantitation (RQ) of different exons of the PSAP gene were obtained using the 7500 software package version 2.0 by the 2− ΔΔCT relative quantification method.

3. Results

3.1. Sanger sequencing of PSAP gene

A heterozygous exonic missense mutation c.1133C > G (p.Pro378Arg) was identified by Sanger sequencing in the proband and his mother (Fig. 1, Panel A). No mutation in PSAP gene was found in patient's father. The mutation, which is located in exon 10 of the PSAP gene, has not been documented in any public database, neither in our internal exonic database of OMIM genes from 800 individuals, and was predicted by MutationTaster (http://www.mutationtaster.org/) to be “disease-causing”.

Fig. 1

Fig. 1

The molecular analysis of PSAP gene at DNA and RNA level. The patient inherited a c.1133C > G (p.P378R) mutation from his mother (Panel A). The RNA sequencing revealed c.1133C > G mutation in a homozygous status (Panel B).

 

3.2. RNA expression of PSAP gene

In order to identify other mutations, we analyzed the RNA extracted from patient's blood. We verified the same missense c.1133C > G (p.Pro378Arg) mutation at the RNA level. However, RNA sequencing revealed monoallelic expression of this mutation (Fig. 1, Panel B). The RNA sequencing finding suggested a possible deletion of another allele.

3.3. Whole genome sequencing identified a large deletion in PSAP gene

Beside the missense mutation c.1133C > G (p.Pro378Arg) already identified by Sanger sequencing, the whole genome sequencing revealed a 10,466 bp deletion ranging from genomic position 73,583,712 to 73,594,178 in 10q22.1 (Fig. 2). This deletion spans from exons 2 through exon 7 of PSAP gene.

Fig. 2

Fig. 2

Whole genome analysis revealed a segmental deletion including Exon 2 and 7 of PSAP gene. A. Visualization of deletion with IGV software. B. Reads alignment on the right breaking point of PSAP gene. C. Reads alignment on the left breaking point of PSAP gene.

 

3.4. Quantitative real-time PCR of PSAP gene

To identify the parental origin of the deletion, a quantitative real-time PCR was carried out. The relative abundance of the patient's exon 2–7 in PSAP gene was half of that in normal control and his parents (Fig. 3), indicating the segmental deletion observed in the patient was not parentally inherited and this de novo deletion spanned from exon 2 through exon 7. The paternity was confirmed by microsatellite analysis.

Fig. 3

Fig. 3

Real-time PCR gene analysis of PSAP gene. Histograms of E2, E7 and E8 represent copy number of exon 2, exon 7 and exon 8 in the PSAP gene respectively. Copy number of E8 is normal. The lower height of histograms in E2 and E7 confirm deletion of one allele of PSAP gene from Exon 2 to Exon 7.

 

4. Discussion

We here present a case of Gaucher disease which resulted from Sap C deficiency. The patient mainly manifested hepatosplenomegaly since the age of 2 year. At his first presentation to hospital, Gaucher disease was suspected due to hepatosplenomegaly, thrombocytopenia, anemia and the presence of Gaucher cells in the bone marrow. In view of normal level of glucocerebrosidase and elevated levels of chitotriosidase and glucosylsphingosine, the PSAP gene was tested. After the demonstration of two heterozygous mutations in the PSAP gene, Gaucher disease due to sap C deficiency was confirmed. Based on the clinical features, the patient was classified as type 1 GD. In a previous report, a patient described as having a non-neuropathic form of Sap C deficient Gaucher disease was treated with miglustat and nevertheless experienced slow deterioration of both peripheral and central nervous systems [16]. Whether our patient will convert into type 3 GD will require a comparatively long time of following-up.

Over 350 variations associated with GD in GBA gene have been identified [1], yet mutations related to GD in PSAP gene are limited. To date, six patients with sap C deficiency, carrying eight different mutations, have been described in the literature [17], [18], [19], [20], [21], [22], [23], [24], and [25]. Among them, one exhibited a type 1 GD phenotype while the other five were characterized as GD type 3. Mutations including p.Met1Leu, p.Met1Val, p.Cys315Ser, p.Leu349Pro, p.Cys382Phe, p.Cys382Gly, and p.342_348FDKMCSKdel had been identified [26], with five of them including p.Cys315Ser, p.Leu349Pro, p.Cys382Gly, p.Cys382Phe and p.342_348FDKMCSKdel located in the sap C domain and four of them, p.Cys315Ser, p.Cys382Gly, p.Cys382Phe, and p.342_348FDKMCSKdel involved with cysteine residue and affecting the binding site for disulfide bridges [26]. Descriptions of the genotypes and phenotypes in these patients are summarized in Table 1.

Table 1

Summary of Gaucher disease patients with saposin C deficiency.

 

P Gender Clinical features Mutations Exon Amino acid changes GD type Origin References
1 Female Hepatosplenomegaly, seizure c.1145G > T/unknown E11/unknown p.C382F/unknown 3 Sweden [17] and [18]
2 Male Hepatosplenomegaly, seizure,ataxia,tremor, ophthalmoplegia c.1144T > G/c.1288C > T E11/E12 p.C382G/p.Q430X 3 Spanish [19], [20], [21], and [22]
3 Female Hepatosplenomegaly, intellectual decline, epilepsy c.1A > G/c.943T > A E1/E10 p.M1V/p.C315S 3 French [23]
4 Male Hepatosplenomegaly, osteopenia c.1A > T/c.1046T > C E1/E10 p.M1L/p.L349P 3 Polish [16] and [24]
5 Female Hepatosplenomegaly, osteopenia c.1A > T/c.1046T > C E1/E10 p.M1L/p.L349P 3 Polish [16] and [24]
6 Female Hepatosplenomegaly c.1024_1044delTTTGACAAAATGTGCTCGAAG E10/E10 p.342_348FDKMCSKdel/p.342_348FDKMCSKdel 1 Indian Sikh [25]
7 Male Hepatosplenomegaly, thrombocytopenia, anemia, abnormal electroencephalogram c.1133C > G/delE2-E7 E10/E2-E7 p.P378R/nonsense mediated mRNA decay 1 Chinese This case

Among the five reported mutations in the Sap C domain of the PSAP gene, four of the five were exonic missense mutations and another one was a small deletion. There is no clear correlation between phenotype and genotype. In this paper, we report an additional missense mutation c.1133C > G (p.Pro378Arg) and a large deletion comprising exon 2 to exon 7 in PSAP gene in a Chinese patient, which was in agreement with previous finding that most mutations of PSAP gene were exonic missense. Both of two mutations are reported for the first time and it is also the first time a large deletion in PSAP gene reported.

The missense mutation was located on the Sap C domain of the PSAP gene, where its pathologic mutations were associated with GD. The nucleotide change presumed to cause the substitution of proline at position 378 with arginine. Proline 378 is highly conserved as being identical in human (NP_001035931.1), murine (NP_035309.2), rat (NP_037145.1), and bovine (NP_776586.1) [26], which was presumed to play an important role in the Sap C domain. Although it lies away from cysteine residue and possibly does not affect the binding site for disulfide bridges, Pro378Arg change could be deleterious for the function of Sap C protein. Due to the fact that this variant is absent from ExAC database and any other control database, it is in trans with another pathogenic variant (the exon 2–7 deletion in this patient), and multiple line of computational evidence support a deleterious effect on the gene and the patient's phenotype is highly specific for Gaucher disease, this missense variant can be classified as likely pathogenic following the ACMG/AMP sequence variant pathogenicity classification guideline [27]. Further functional studies could ultimately prove the pathogenicity of this missense variant.

Along with the missense mutation, a deletion on the second allele of PSAP gene was identified. This deletion was as large as 10,466 bp, spanning exons from 2 to 7. Based on previous literature, exon 3, 4, and 5 of PSAP gene encode the Sap A domain, exon 6, 7, 8, and 9 encode the Sap B domain, while Sap C and D are encoded by 10,11, or 12,13,14, respectively [22]. The deletion identified spanned from Sap A to B domain.

It is assumed that multi-exon deletion can disrupt protein function through lack of transcription and complete absence of the gene product. Therefore, multi-exon deletion is moderate evidence of pathogenicity. The larger the deletions, the more likely are they to be pathogenic [27]. In our patient, the deletion covered 6 exons of the total 15 exons in the PSAP gene, and was 10,499 bp in length. The RNA analysis of this patient revealed no aberrant transcripts from the shorted PSAP gene, indicating nonsense mediated mRNA decay involved.

Although Gaucher disease resulting from saposin C deficiency has been reported as early as 1986 [17], it is rarely diagnosed in China. It is possibly that lack of recognition and knowledge of saposin C deficiency often leads to this disease being under-diagnosed. In this study, the first Chinese Gaucher disease patient due to saposin C deficiency caused by two heterozygous mutations in PSAP gene displayed typical clinical features of type 1 GD. Based on our findings, saposin C deficiency should be considered in view of the normal glucocerebrosidase activity and high level of chitotriosidase and glucosylsphingosine in patients with unexplained hepatosplenomegaly.

In summary, we report two novel mutations in the PSAP gene. The result of our study on the genetic basis of Gaucher disease in a Chinese patient contributes to the variation panel of the PSAP gene in Asia countries. Understanding the biochemical and clinical features in the saposin C deficiency patient is critical to establish procedures for diagnosing this disease.

Acknowledgements

This work was supported by NSFC (81570516, 81270936), Shanghai Science and Technology Committee (16JC1404600), and Shanghai Municipal Education Commission-Gaofeng Clinical Medicine Grant Support (20152520) to Huiwen Zhang.

References

  • [1] S. Mattošová, J. Chandoga, A. Hlavatá, J. Saligová, D. Maceková. Spectrum of GBA mutations in patients with Gaucher disease from Slovakia: identification of five novel mutations. Isr. Med. Assoc. J.. 2015;17:166-170
  • [2] J. O'Brien, Y. Kishimoto. Saposin proteins: structure, function, and role in human lysosomal storage disorders. FASEB J.. 1991;5:301-3008
  • [3] A.M. Vaccaro, M. Motta, M. Tatti, S. Scarpa, L. Masuelli, M. Bhat, M.T. Vanier, A. Tylki-Szymanska, R. Salvioli. Saposin C mutations in Gaucher disease patients resulting in lysosomal lipid accumulation, saposin C deficiency, but normal prosaposin processing and sorting. Hum. Mol. Genet.. 2010;19:2987-2997
  • [4] A. Tajima, T. Yokoi, M. Ariga, T. Ito, E. Kaneshiro, Y. Eto, H. Ida. Clinical and genetic study of Japanese patients with type 3 Gaucher disease. Mol. Genet. Metab.. 2009;97:272-277
  • [5] P.K. Mistry, M.D. Cappellini, E. Lukina, H. Ozsan, S. Mach Pascual, H. Rosenbaum, M. Helena Solano, Z. Spigelman, J. Villarrubia, N.P. Watman, G. Massenkeil. A reappraisal of Gaucher disease-diagnosis and disease management algorithms. Am. J. Hematol.. 2011;86:110-115
  • [6] R.J. Tamargo, A. Velayati, E. Goldin, E. Sidransky. The role of saposin C in Gaucher disease. Mol. Genet. Metab.. 2012;106:257-263
  • [7] L. Yuan, C.R. Morales. Prosaposin sorting is mediated by oligomerization. Exp. Cell Res.. 2011;317:2456-2467
  • [8] S. Igdoura, C. Morales. Role of sulfated glycoprotein-1 (SGP-1) in the disposal of residual bodies by sertoli cells of the rat. Mol. Reprod. Dev.. 1995;40:91-102
  • [9] M. Motta, M. Tatti, F. Furlan, A. Celato, G. Di Fruscio, G. Polo, R. Manara, V. Nigro, M. Tartaglia, A. Burlina, R. Salvioli. Clinical, biochemical and molecular characterization of prosaposin deficiency. Clin. Genet.. 2016;90:220-229
  • [10] A. Vaccaro, R. Salvioli, A. Barca, M. Tatti, F. Ciaffoni, B. Maras, R. Siciliano, F. Zappacosta, A. Amoresano, P. Pucci. Structural analysis of saposin C and B. Complete localization of disulfide bridges. J. Biol. Chem.. 1995;270:9953-9960
  • [11] M. Elleder, M. Jerábková, A. Befekadu, M. Hrebícek, L. Berná, J. Ledvinová, H. Hůlková, H. Rosewich, N. Schymik, B. Paton, K. Harzer. Prosaposin deficiency — a rarely diagnosed, rapidly progressing, neonatal neurovisceral lipid storage disease. Report of a further patient. Neuropediatrics. 2005;36:171-180
  • [12] M. Hiraiwa, B. Martin, Y. Kishimoto, G. Conner, S. Tsuji, J. O'Brien. Lysosomal proteolysis of prosaposin, the precursor of saposins (sphingolipid activator proteins): its mechanism and inhibition by ganglioside. Arch. Biochem. Biophys.. 1997;341:17-24
  • [13] J. Matsuda, M. Kido, K. Tadano-Aritomi, I. Ishizuka, K. Tominaga, K. Toida, E. Takeda, K. Suzuki, Y. Kuroda. Mutation in saposin D domain of sphingolipid activator protein gene causes urinary system defects and cerebellar purkinje cell degeneration with accumulation of hydroxy fatty acid-containing ceramide in mouse. Hum. Mol. Genet.. 2004;13:2709-2723
  • [14] L. Kang, X. Zhan, X. Gu, H. Zhang. Successful newborn screening for Gaucher disease using fluorometric assay in China. J. Hum. Genet.. Mar 30 2017; 10.1038/jhg.2017.36
  • [15] H. Li, R. Durbin. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009;25:1754-1760
  • [16] A. Tylki-Szymanska, J.E. Groener, M.L. Kaminski, A. Lugowska, E. Jurkiewicz, B. Czartoryska. Gaucher disease due to saposin C deficiency, previously described as non-neuronopathic form—no positive effects after 2-years of miglustat therapy. Mol. Genet. Metab.. 2011;104:627-630
  • [17] H. Christomanou, A. Aignesberger, R. Linke. Immunochemical characterization of two activator proteins stimulating enzymic sphingomyelin degradation in vitro. Absence of one of them in a human Gaucher disease variant. Biol. Chem. Hoppe Seyler. 1986;367:879-890
  • [18] D. Schnabel, M. Schröder, K. Sandhoff. Mutation in the sphingolipid activator protein 2 in a patient with a variant of Gaucher disease. FEBS Lett.. 1991;284:57-59
  • [19] H. Christomanou, A. Chabás, T. Pámpols, A. Guardiola. Activator protein deficient Gaucher's disease. A second patient with the newly identified lipid storage disorder. Klin. Wochenschr.. 1989;67:999-1003
  • [20] M. Rafi, G. de Gala, X. Zhang, D. Wenger. Mutational analysis in a patient with a variant form of Gaucher disease caused by SAP-2 deficiency. Somat. Cell Mol. Genet.. 1993;19:1-7
  • [21] T. Pàmpols, M. Pineda, M. Girós, I. Ferrer, V. Cusi, A. Chabás, F. Sanmarti, M. Vanier, H. Christomanou. Neuronopathic juvenile glucosylceramidosis due to sap-C deficiency: clinical course, neuropathology and brain lipid composition in this Gaucher disease variant. Acta Neuropathol.. 1999;97:91-97
  • [22] A. Diaz-Font, B. Cormand, R. Santamaria, L. Vilageliu, D. Grinberg, A. Chabas. A mutation within the saposin D domain in a Gaucher disease patient with normal glucocerebrosidase activity. Hum. Genet.. 2005;117:275-277
  • [23] D. Amsallem, D. Rodriguez, M. Vanier, N. Khayat, G. Millat, M. Campello, C. Guillame, D. Billette, T. Villemeur. Third case of Gaucher disease with sap-C deficiency and evaluation of twelve months' therapy by miglustat. J. Inherit. Metab. Dis.. 2005;28:152
  • [24] A. Tylki-Szymanska, B. Czartoryska, M.T. Vanier, B.J. Poorthuis, J.A. Groener, A. Lugowska, G. Millat, A.M. Vaccaro, E. Jurkiewicz. Non-neuronopathic Gaucher disease due to saposin C deficiency. Clin. Genet.. 2007;72:538-542
  • [25] M. Vanier, G. Millat. Are sphingolipid activator deficiencies underdiagnosed. Int. J. Clin. Pharmacol. Ther.. 2009;47:S147-S148
  • [26] M. Motta, S. Camerini, M. Tatti, M. Casella, P. Torreri, M. Crescenzi, M. Tartaglia, R. Salvioli. Gaucher disease due to saposin C deficiency is an inherited lysosomal disease caused by rapidly degraded mutant proteins. Hum. Mol. Genet.. 2014;23:5814-5826
  • [27] S. Richards, N. Aziz, S. Bale, D. Bick, S. Das, J. Gastier-Foster, W.W. Grody, M. Hegde, E. Lyon, E. Spector, K. Voelkerding, H.L. Rehm. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med.. 2015;17:405-424

Footnotes

Pediatric Endocrinology and Genetic, Xin Hua Hospital, Shanghai Institute for Pediatric Research, Shanghai Jiao Tong University School of Medicine, China

Corresponding author at: Pediatric Endocrinology and Genetic, Xin Hua Hospital, Shanghai Institute for Pediatric Research, Shanghai Jiao Tong University School of Medicine, Kongjiang Road 1665 #, 200092, Shanghai, China.

The authors declare that they have no conflict of interest.